Skip to content
Back

Primary Open Angle Glaucoma (Basset Hound Type)

Primary Open Angle Glaucoma (Basset Hound Type) is a genetic eye condition causing increased eye pressure, pain, and gradual vision loss in affected dogs.

Affected Genes: ADAMTS17

Inheritance: Autosomal Recessive

Variant(canFam6):
chr3:43306384-43306403 19 bp deletion CCCGCGCGCCCCTCGGCGCC

Breed: Basset Hound

General Information: Primary Open Angle Glaucoma (POAG) in Basset Hounds is an inherited eye condition characterized by excessive eye pressure that leads to enlargement of the eye and significant pain. Affected dogs often show signs of discomfort such as excessive blinking, tearing, and redness. If left untreated, the increased pressure causes the eyes to bulge, damages the optic nerve, and results in gradual vision loss. This condition is poorly responsive to treatment, making early detection and management crucial.

How to Read Your Dog's Test Results for this Genetic Variant:

Two Variants Detected: Dog Likely Affected

One Variant Detected: Dog Unlikely Affected

No Variants Detected: No Effect

Gene / Testing Information: Genetic testing for POAG in Basset Hounds focuses on the ADAMTS17 gene. This condition follows an autosomal recessive inheritance pattern, requiring a dog to inherit two copies of the mutated gene (one from each parent) to be affected. Carrier dogs, which have one normal and one mutated gene, do not show symptoms but can pass the mutation to their offspring. Breeding two carriers poses a 25% chance of producing an affected puppy and a 50% chance of producing a carrier. Genetic testing is essential for responsible breeding to prevent producing affected pups. By breeding carriers only with dogs that do not carry the mutation, breeders can eliminate this condition from their lines. Since symptoms may not appear until adulthood, it is vital to perform genetic testing before breeding to ensure healthy offspring.

References:
Oliver JAC, Forman OP, Pettitt L, Mellersh CS. Correction: Two Independent Mutations in ADAMTS17 Are Associated with Primary Open Angle Glaucoma in the Basset Hound and Basset Fauve de Bretagne Breeds of Dog. PLoS One 2016 11(5):e0156192.

Oliver JAC, Forman OP, Pettitt L, Mellersh CS. Two Independent Mutations in ADAMTS17 Are Associated with Primary Open Angle Glaucoma in the Basset Hound and Basset Fauve de Bretagne Breeds of Dog. PLoS One 2015 10(10):e0140436.